90
|
PrimerDesign Inc
perl primer program Perl Primer Program, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/perlprimer++version+1+1+21/pm39523383-117-10-0 Average 90 stars, based on 1 article reviews
perl primer program - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
99
|
Thermo Fisher
taq dna polymerase Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/DNA/pm15709156-91-34-37 Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
96
|
New England Biolabs
pcr reactions Pcr Reactions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/SARS-CoV/med_rxiv__2023__03__14__23287217-145-8-32 Average 96 stars, based on 1 article reviews
pcr reactions - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
90
|
5 PRIME
2.5×5 prime mastermix 2.5×5 Prime Mastermix, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/2+5%C3%975+prime+mastermix/pmc04065118-116-23-25 Average 90 stars, based on 1 article reviews
2.5×5 prime mastermix - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
neb next high fidelity 2x pcr master mix Neb Next High Fidelity 2x Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/NEBNext+High-Fidelity+PCR+Master+Mix/bio_rxiv__2022__05__14__491965-215-30-30 Average 99 stars, based on 1 article reviews
neb next high fidelity 2x pcr master mix - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
95
|
Thermo Fisher
well plates Well Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/12-Well+Elution+Strips+for+KingFisher+Duo+Prime+Magnetic+Particle+Processor/pmc03511915-101-14-21 Average 95 stars, based on 1 article reviews
well plates - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
99
|
Cytiva Europe
ecl western blotting detection Ecl Western Blotting Detection, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/ECL+Detection+Reagents/pmc04580420-97-8-16 Average 99 stars, based on 1 article reviews
ecl western blotting detection - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
96
|
Eppendorf AG
adaptor primer 5 ggaatcagtcagtaattggagg Adaptor Primer 5 Ggaatcagtcagtaattggagg, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/Adaptor/10__1094_slash_phyto___99___10___1142-119-6-16 Average 96 stars, based on 1 article reviews
adaptor primer 5 ggaatcagtcagtaattggagg - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
99
|
New England Biolabs
1x nebnext ultra ii q5 master mix 1x Nebnext Ultra Ii Q5 Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/NEBNext+Ultra+II+Q5+Master+Mix/pm41237776-914-20-21 Average 99 stars, based on 1 article reviews
1x nebnext ultra ii q5 master mix - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
genesis real-time pcr sars-cov-2 kit Genesis Real Time Pcr Sars Cov 2 Kit, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/genesig++coronavirus+sars+cov+2+real+time+pcr+assay+kit/pmc08126174-97-24-29 Average 90 stars, based on 1 article reviews
genesis real-time pcr sars-cov-2 kit - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
perl script primer4fttlp.pl Perl Script Primer4fttlp.Pl, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/perl+script+primer4fttlp+pl/pmc01475441-506-11-6 Average 90 stars, based on 1 article reviews
perl script primer4fttlp.pl - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Isentio AS
ripseq mixed Ripseq Mixed, supplied by Isentio AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/perl+primer+standalone+software/ripseq+mixed/pmc03168215-192-16-18 Average 90 stars, based on 1 article reviews
ripseq mixed - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |