perl primer standalone software Search Results


90
PrimerDesign Inc perl primer program
Perl Primer Program, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/perlprimer++version+1+1+21/pm39523383-117-10-0
Average 90 stars, based on 1 article reviews
perl primer program - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
Thermo Fisher taq dna polymerase
Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/DNA/pm15709156-91-34-37
Average 99 stars, based on 1 article reviews
taq dna polymerase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
New England Biolabs pcr reactions
Pcr Reactions, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/SARS-CoV/med_rxiv__2023__03__14__23287217-145-8-32
Average 96 stars, based on 1 article reviews
pcr reactions - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
5 PRIME 2.5×5 prime mastermix
2.5×5 Prime Mastermix, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/2+5%C3%975+prime+mastermix/pmc04065118-116-23-25
Average 90 stars, based on 1 article reviews
2.5×5 prime mastermix - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
New England Biolabs neb next high fidelity 2x pcr master mix
Neb Next High Fidelity 2x Pcr Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/NEBNext+High-Fidelity+PCR+Master+Mix/bio_rxiv__2022__05__14__491965-215-30-30
Average 99 stars, based on 1 article reviews
neb next high fidelity 2x pcr master mix - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

95
Thermo Fisher well plates
Well Plates, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/12-Well+Elution+Strips+for+KingFisher+Duo+Prime+Magnetic+Particle+Processor/pmc03511915-101-14-21
Average 95 stars, based on 1 article reviews
well plates - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
Cytiva Europe ecl western blotting detection
Ecl Western Blotting Detection, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/ECL+Detection+Reagents/pmc04580420-97-8-16
Average 99 stars, based on 1 article reviews
ecl western blotting detection - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Eppendorf AG adaptor primer 5 ggaatcagtcagtaattggagg
Adaptor Primer 5 Ggaatcagtcagtaattggagg, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/Adaptor/10__1094_slash_phyto___99___10___1142-119-6-16
Average 96 stars, based on 1 article reviews
adaptor primer 5 ggaatcagtcagtaattggagg - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
New England Biolabs 1x nebnext ultra ii q5 master mix
1x Nebnext Ultra Ii Q5 Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/NEBNext+Ultra+II+Q5+Master+Mix/pm41237776-914-20-21
Average 99 stars, based on 1 article reviews
1x nebnext ultra ii q5 master mix - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
PrimerDesign Inc genesis real-time pcr sars-cov-2 kit
Genesis Real Time Pcr Sars Cov 2 Kit, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/genesig++coronavirus+sars+cov+2+real+time+pcr+assay+kit/pmc08126174-97-24-29
Average 90 stars, based on 1 article reviews
genesis real-time pcr sars-cov-2 kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc perl script primer4fttlp.pl
Perl Script Primer4fttlp.Pl, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/perl+script+primer4fttlp+pl/pmc01475441-506-11-6
Average 90 stars, based on 1 article reviews
perl script primer4fttlp.pl - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Isentio AS ripseq mixed
Ripseq Mixed, supplied by Isentio AS, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/perl+primer+standalone+software/ripseq+mixed/pmc03168215-192-16-18
Average 90 stars, based on 1 article reviews
ripseq mixed - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results